Showing posts with label ATL1102. Show all posts
Showing posts with label ATL1102. Show all posts

Thursday, 3 April 2014

ATL1102 for MS – Toxicology Study Main Findings

Sequence Type: DNA fragment
CTGAGTCTGTTTTCCATTCT
ATL 1102
The antisense oligonucleotide is complementary to a region in the 3'UTR of human ITGA4 (integrin alpha 4) cDNA whose sequence is 5'-CTGAGTCTGTTTTCCATTCT-3'
Phosphorothioate antisense oligonucleotide consisting of a 9-nucleotide central region of deoxynucleotides flanked by 3 2'-O-methoxyethyl (2'-MOE) nucleotides on the 5' end and 8 2'-MOE nucleotides on the 3' end.
TOORAK, Australia, April 1, 2014 /PRNewswire/ -- Antisense Therapeutics Limited ("ANP" or the "Company") is pleased to advise that results from a chronic toxicity study in monkeys indicate that ATL1102, an antisense oligonucleotide currently under development for the treatment of multiple sclerosis (MS), was well-tolerated when given subcutaneously for a 6-month dosing period at the 2 dose levels tested (1.5 and 3mg/kg/dose). The Company believes that the preclinical and clinical experience to date with ATL1102 should allow dosing in future trials at or above the 1.5 mg/kg/dose level.
read at
http://www.sys-con.com/node/3037721

ATL-1102
ISIS-107248
TV-1102
ITGA4 Expression Inhibitors
Signal Transduction Modulators
PHASE 2
Antisense Therapeutics
Isis Pharmaceuticals
Antisense Therapeutics Limited (ASX: ANP) is an Australian publicly listed biopharmaceutical drug discovery and development company. Its mission is to create, develop and commercialise second generation antisense pharmaceuticals for large unmet markets. ANP has 4 products in its development pipeline that it has in-licensed from Isis Pharmaceuticals Inc., world leaders in antisense drug development and commercialisation - ATL1102 (injection) which has successfully completed a Phase II efficacy and safety trial, significantly reducing the number of brain lesions in patients with multiple sclerosis, ATL1103 a second-generation antisense drug designed to block GHr production and thereby lower blood IGF-I levels and is in clinical development as a potential treatment for growth and other GH-IGF-I disorders, ATL1102 (inhaled) which is at the pre-clinical research stage as a potential treatment for asthma and ATL1101 a second-generation antisense drug at the pre-clinical stage being investigated as a potential treatment for cancer.
ATL1102 is a second generation antisense inhibitor of CD49d, a subunit of VLA-4 (Very Late Antigen-4). In inflammation, white blood cells (leukocytes) move out of the bloodstream into the inflamed tissue, for example, the Central Nervous System (CNS) in MS, and the lung airways in asthma. The inhibition of VLA-4 may prevent white blood cells from entering sites of inflammation, thereby slowing progression of the disease. VLA-4 is a clinically validated target in the treatment of MS. Antisense inhibition of VLA-4 has demonstrated positive effects in a number of animal models of inflammatory disease including MS with the MS animal data having been published in a peer reviewed scientific journal. ATL1102 was previously shown by Antisense Therapeutics to be highly effective in reducing MS lesions in a Phase IIa clinical trial in MS patients.
ATL-1102 is an antisense oligonucleotide in phase II clinical trials at Isis Pharmaceuticals and Antisense Therapeutics for the treatment of relapsing-remitting multiple sclerosis (MS) in a subcutaneous injection formulation. Phase I clinical trials in a subcutaneous injections for stem cell mobilization and preclinical studies of an inhalation formulation of the drug candidate for the treatment of asthma are also being conducted at Antisense Therapeutics.
ATL-1102 is complementary to nt 4288-4207 (3'UTR) of human integrin alpha 4 (ITGA4) cDNA, and thus inhibits ITGA4 expression, blocking the synthesis of CD49d, a subunit of very late antigen-4 (VLA-4). VLA-4 is known to play a part in both the onset and progression of MS, and its inhibition may prevent white blood cells from entering the central nervous system.
ATL-1102 was originally developed at Isis Pharmaceuticals. In December 2001, Isis and Circadian Technologies formed Antisense Therapeutics, established to focus on the discovery and development of antisense therapeutics. As part of the company's formation, Antisense Therapeutics received a license to ATL-1102 and entered into a five-year antisense drug discovery and development program with Isis. In 2008, Antisense licensed ATL-1102 to Teva. In 2010, Teva terminated its licensee agreement with Antisense for the development of ATL-1102 for the treatment of relapsing-remitting multiple sclerosis. The company stated that the compound was not on line with its preferred product pipeline. In 2001, ATL-1102 was licensed to Antisense Therapeutics by Isis Pharmaceuticals. In 2012, development and commercialization rights to the product were licensed to Tianjin International Joint Academy of Biotechnology and
Contact Information:
Website: www.antisense.com.au
Managing Director: Mark Diamond +61 (3) 9827 8999
USA Investor/Media: Joshua Drumm +(1) 212 375 2664;jdrumm@tiberend.com
Australia Investor/Media: Simon Watkin +61 (0)413 153 272;simon@marketconnect.com.au
SOURCE Antisense Therapeutics Limited